Specimen data, digital object, and hashed ledger

https://dilbert.com/strip/2018-06-06

The problem

In this view, each actor working with a particular process and data repository/source. We create blocks based on the workflow and link them together. In the simplest form, the blocks will just include the hashes instead of the data.
- test/cae42177c14a8fcdeb14: Physical specimen in a museum (tied to a scientific name) 
- test/db44501292f3e4c35f8e: A digital specimen that creates a digital representation of a physical item and provides the various other links
- test/b0ac8fc9596372bc3c97: is the researcher/scientists
- test/8d485a744ebad89f6349: is the digitization manager
- EF215838 is the database record id from the DNA sequence database

Create my first block

>>> from blockchain import Message, Block, Blockchain
>>> import pickle
>>> B1 = Block()
>>> B1.add_message(Message("test/b0ac8fc9596372bc3c97 deposited test/cae42177c14a8fcdeb14 in test/a49a51ac540d68915229"))
B1.add_message(Message("test/8d485a744ebad89f6349 digitized test/cae42177c14a8fcdeb14"))
>>> B1.__dict__
{'timestamp': None, 'messages': [Message<hash: f35736c42b0cbde8ca320148802755029b5958d9148f1022d431c0b6abd49f13, prev_hash: None, sender: None, receiver: None, data: test/b0ac8fc9596372bc3c97>, Message<hash: f44bd62f8afdb868679278784dc5a509d1d64c19dab5963ae1eab7c5aadca47a, prev_hash: f35736c42b0cbde8ca320148802755029b5958d9148f1022d431c0b6abd49f13, sender: None, receiver: None, data: test/8d485a744ebad89f6349>], 'hash': None, 'prev_hash': None}

Seal and validate

>>> B1.seal()
>>> B1.validate()
>>> B1
Block<hash: 4cf253428a5d8f9ef20c64015fb88bfbb3fcd60b11ff045ed9c7d906f714d537, prev_hash: None, messages: 2, time: 1575925690.53>
>>> B2 = Block()
>>> B2
Block<hash: None, prev_hash: None, messages: 0, time: None>
>>> B2.add_message(Message("test/8d485a744ebad89f6349 digitized test/cae42177c14a8fcdeb14"))
>>> B2.add_message(Message("DNA accession EF215838 is sourced from test/cae42177c14a8fcdeb14"))
>>> B2.add_message(Message("EF215838 sequence is CAGATGGGCCGAAAGGCCCA"))
>>> B2
Block<hash: None, prev_hash: None, messages: 3, time: None>
>>> B2.seal()
>>> B2.validate()
>>> B2
Block<hash: 67ec631826f503dbfe702c9250ec8f73669729a073876d361e684b070192513e, prev_hash: None, messages: 3, time: 1575926036.86>

Chain the blocks

>>> chain = Blockchain()
>>> chain.add_block(B1)
>>> chain.add_block(B2)
>>> chain.blocks[1].messages[1].data
'DNA accession EF215838 is sourced from test/cae42177c14a8fcdeb14'
>>> chain.blocks[1].messages[2].data
'EF215838 sequence is CAGATGGGCCGAAAGGCCCA'

Tamper data

>>> pickle.dump(chain2, open('chain.p', 'wb'))
>>> tampered = pickle.load(open('chain.p', 'rb'))
>>> tampered.blocks[1].messages[2].data = "EF215838 sequence is ACGATGGGCCGAAAGGCCCA"
>>> pickle.dump(tampered, open('chain.p', 'wb'))
>>> chain3 = pickle.load(open('chain.p', 'rb'))
>>> chain3.validate() 
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "blockchain.py", line 116, in validate
raise InvalidBlockchain("Invalid blockchain at block {} caused by: {}".format(i, str(ex)))
blockchain.InvalidBlockchain: Invalid blockchain at block 1 caused by: Invalid block: Message #2 failed validation: Invalid payload hash in message: Message<hash: e28c7fcc52fca2a375c32246adc5b38b4ae5d54b32d3861c096c2d9a2b80383c, prev_hash: fd0cf09adf871458f9eb38bad7023306e539c7e9daecd48605282529f8268ee3, sender: None, receiver: None, data: EF215838 sequence is ACGA>HERE 4c65e09280b1e68199be03569c2df75d95d3f1534fb73b9e496d8e9f422b379f. In block: Block<hash: 60d76c7d06cc770f37dbf9cbaef6433bb4b5ef8b6e7d933810fb570fdb930378, prev_hash: 344182a9b9565a6d0b6633232619cd9834a23e1e19252ace87b53aebef6ecd5a, messages: 3, time: 1575926137.01>

--

--

--

Data Architect@Distributed System of Scientific Collections (https://dissco.eu). PhD in Sociology. Bachelor's in Math and CS from the University of Illinois.

Love podcasts or audiobooks? Learn on the go with our new app.

Recommended from Medium

Editor’s Notes: Monitoring the regulatory landscape around DeFi.

Blockchain : The Future Of Technology

5 Projects Built on Quorum that Applied to the UN’s Sustainable Goals Program

Lendefi Community Update

Trontopia & Trontrade AMA

Next Generation World Wide Web: Web3 Based on Blockchain

Hive Investments x Chainlink

Eliminate Data Inefficiencies Using Scidex Decentralized MarketSpace

Get the Medium app

A button that says 'Download on the App Store', and if clicked it will lead you to the iOS App store
A button that says 'Get it on, Google Play', and if clicked it will lead you to the Google Play store
Sharif Islam

Sharif Islam

Data Architect@Distributed System of Scientific Collections (https://dissco.eu). PhD in Sociology. Bachelor's in Math and CS from the University of Illinois.

More from Medium

Deploy any High Resource Node on Akash

CS371p Spring 2022 — Week8 Blog: Ziwen Guo

CS371p Spring 2022: Daniel Cai: Final Entry

CS373 Spring 2022: Sahran Hashim